| CDS ID | Os11t0199200-02 |
| CDS Infomation | cds chromosome:IRGSP-1.0:11:4971319:4973964:-1 gene:Os11g0199200 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:ENDOSPERM STORAGE PROTEIN 2, PROTEIN DISULFIDE ISOMERASE-LIKE 1;1, PROTEIN DISULFIDE ISOMERASE-LIKE 1-1, protein disulfide-isomerase, PDI-like protein 1-1, Protein Disulfide Isomerase Like 1-1, endosperm storage protein2, endosperm storage protein 2, endosperm storage protein-2, endosperm storage protein mutant2 description:Protein disulfide isomerase-like enzyme, Starch synthesis, Maturation of proglutelin in endosperm (Os11t0199200-01);Similar to Protein disulfide isomerase. (Os11t0199200-02) |
| Sequence | GTTGATGCCAACGACGAGAAGAACAAGCCTCTTGCTACCAAGTATGAGATCCAGGGTTTC |
| PEP ID | Os11t0199200-02 |
| PEP Infomation | pep chromosome:IRGSP-1.0:11:4971319:4973964:-1 gene:Os11g0199200 transcript:Os11t0199200-02 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:ENDOSPERM STORAGE PROTEIN 2, PROTEIN DISULFIDE ISOMERASE-LIKE 1;1, PROTEIN DISULFIDE ISOMERASE-LIKE 1-1, protein disulfide-isomerase, PDI-like protein 1-1, Protein Disulfide Isomerase Like 1-1, endosperm storage protein2, endosperm storage protein 2, endosperm storage protein-2, endosperm storage protein mutant2 description:Protein disulfide isomerase-like enzyme, Starch synthesis, Maturation of proglutelin in endosperm (Os11t0199200-01);Similar to Protein disulfide isomerase. (Os11t0199200-02) |
| Sequence | VDANDEKNKPLATKYEIQGFPTLKIFRNQGKNIQEYKGPREAEGIVEYLKKQVGPASKEI |
| Transcript ID | Os11t0199200-02 |
| Transcript Infomation | cdna chromosome:IRGSP-1.0:11:4971319:4973964:-1 gene:Os11g0199200 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:ENDOSPERM STORAGE PROTEIN 2, PROTEIN DISULFIDE ISOMERASE-LIKE 1;1, PROTEIN DISULFIDE ISOMERASE-LIKE 1-1, protein disulfide-isomerase, PDI-like protein 1-1, Protein Disulfide Isomerase Like 1-1, endosperm storage protein2, endosperm storage protein 2, endosperm storage protein-2, endosperm storage protein mutant2 description:Protein disulfide isomerase-like enzyme, Starch synthesis, Maturation of proglutelin in endosperm (Os11t0199200-01);Similar to Protein disulfide isomerase. (Os11t0199200-02) |
| Sequence | GTTGATGCCAACGACGAGAAGAACAAGCCTCTTGCTACCAAGTATGAGATCCAGGGTTTC |