| CDS ID | Os06t0114000-03 |
| CDS Infomation | cds chromosome:IRGSP-1.0:6:811064:815114:-1 gene:Os06g0114000 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:chaperonin 60 beta subunit 1 description:Hypothetical gene. (Os06t0114000-01);Similar to 60 kDa chaperonin (Protein Cpn60) (groEL protein) (63 kDa stress protein) (GSP63). (Os06t0114000-02);Similar to RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment). (Os06t0114000-03);Similar to RuBisCo subunit binding-protein beta subunit (Fragment). (Os06t0114000-04) |
| Sequence | CTTGTTGGAGTTACACTGGGACCAAAGGGAAGGAATGTTGTTTTGGAGAGCAAGTATGGG |
| PEP ID | Os06t0114000-03 |
| PEP Infomation | pep chromosome:IRGSP-1.0:6:811064:815114:-1 gene:Os06g0114000 transcript:Os06t0114000-03 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:chaperonin 60 beta subunit 1 description:Hypothetical gene. (Os06t0114000-01);Similar to 60 kDa chaperonin (Protein Cpn60) (groEL protein) (63 kDa stress protein) (GSP63). (Os06t0114000-02);Similar to RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment). (Os06t0114000-03);Similar to RuBisCo subunit binding-protein beta subunit (Fragment). (Os06t0114000-04) |
| Sequence | LVGVTLGPKGRNVVLESKYGSPRIVNDGVTVAREVELEDPVENIGAKLVRQAAAKTNDLA |
| Transcript ID | Os06t0114000-03 |
| Transcript Infomation | cdna chromosome:IRGSP-1.0:6:811064:815114:-1 gene:Os06g0114000 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:chaperonin 60 beta subunit 1 description:Hypothetical gene. (Os06t0114000-01);Similar to 60 kDa chaperonin (Protein Cpn60) (groEL protein) (63 kDa stress protein) (GSP63). (Os06t0114000-02);Similar to RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment). (Os06t0114000-03);Similar to RuBisCo subunit binding-protein beta subunit (Fragment). (Os06t0114000-04) |
| Sequence | CTTGTTGGAGTTACACTGGGACCAAAGGGAAGGAATGTTGTTTTGGAGAGCAAGTATGGG |