| CDS ID | Os05t0529700-03 |
| CDS Infomation | cds chromosome:IRGSP-1.0:5:26310862:26314166:-1 gene:Os05g0529700 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:DnaJ domain protein C50, rice DJC82 homolog description:Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-01);Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-02);Heat shock protein DnaJ family protein. (Os05t0529700-03) |
| Sequence | ATGGCTCCGCTACCCTCGCCACCGCTGCTGGCCGAATCGCTCGCGACGCTGCGCACAGCC |
| PEP ID | Os05t0529700-03 |
| PEP Infomation | pep chromosome:IRGSP-1.0:5:26310862:26314166:-1 gene:Os05g0529700 transcript:Os05t0529700-03 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:DnaJ domain protein C50, rice DJC82 homolog description:Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-01);Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-02);Heat shock protein DnaJ family protein. (Os05t0529700-03) |
| Sequence | MAPLPSPPLLAESLATLRTASPSPPIPCSPRRTRPLVSARFARTAGRRSRSTGGRRDLRS |
| Transcript ID | Os05t0529700-03 |
| Transcript Infomation | cdna chromosome:IRGSP-1.0:5:26310862:26314166:-1 gene:Os05g0529700 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:DnaJ domain protein C50, rice DJC82 homolog description:Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-01);Similar to electron transporter/ heat shock protein binding protein. (Os05t0529700-02);Heat shock protein DnaJ family protein. (Os05t0529700-03) |
| Sequence | AACCGCCGCCGCCGCCGCCTTCGATTCGATTCCGATCGAGTTGGAGAAGGCCGCCGCTGC |