| CDS ID | Os03t0123300-02 |
| CDS Infomation | cds chromosome:IRGSP-1.0:3:1327843:1331022:1 gene:Os03g0123300 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:TILLERING AND DWARF 1 description:Activator of the anaphase promoting complex/cyclosome (APC/C) complex, Regulation of cell cycle, Regulation of postembryonic shoot branching and tillering, Maintenance of endoreduplication during endosperm development (Os03t0123300-01);Similar to Cell cycle switch protein CCS52A. (Os03t0123300-02) |
| Sequence | TTCGGCCCCACCACGCCCGACCGGGTGGCGTCGTCGGCGTCCGCGTGCTCCTCCTCCTCC |
| PEP ID | Os03t0123300-02 |
| PEP Infomation | pep chromosome:IRGSP-1.0:3:1327843:1331022:1 gene:Os03g0123300 transcript:Os03t0123300-02 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:TILLERING AND DWARF 1 description:Activator of the anaphase promoting complex/cyclosome (APC/C) complex, Regulation of cell cycle, Regulation of postembryonic shoot branching and tillering, Maintenance of endoreduplication during endosperm development (Os03t0123300-01);Similar to Cell cycle switch protein CCS52A. (Os03t0123300-02) |
| Sequence | FGPTTPDRVASSASACSSSSSAGASPVGSPATGNIFRFKAEVPRNAKRALFSDGDDEGVL |
| Transcript ID | Os03t0123300-02 |
| Transcript Infomation | cdna chromosome:IRGSP-1.0:3:1327843:1331022:1 gene:Os03g0123300 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:TILLERING AND DWARF 1 description:Activator of the anaphase promoting complex/cyclosome (APC/C) complex, Regulation of cell cycle, Regulation of postembryonic shoot branching and tillering, Maintenance of endoreduplication during endosperm development (Os03t0123300-01);Similar to Cell cycle switch protein CCS52A. (Os03t0123300-02) |
| Sequence | CTTCGGCCCCACCACGCCCGACCGGGTGGCGTCGTCGGCGTCCGCGTGCTCCTCCTCCTC |