| CDS ID | Os02t0803700-01 |
| CDS Infomation | cds chromosome:IRGSP-1.0:2:34266081:34269923:-1 gene:Os02g0803700 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:rice homolog of HIV-1 Tat binding protein-1, homolog of human TBP-1, 19S regulatory particle ATPase subunit 5a, RP triple A-ATPase 5a description:Similar to 26S protease regulatory subunit 6A homolog (TAT-binding protein homolog 1) (TBP-1). (Os02t0803700-01);Similar to 26S protease regulatory subunit 6A homolog. (Os02t0803700-03) |
| Sequence | ATGTCGTCGCCGCCGCCCGCCGCCGCCGCCGCGATGGCCGTCGACGACGCCGACGACGAC |
| PEP ID | Os02t0803700-01 |
| PEP Infomation | pep chromosome:IRGSP-1.0:2:34266081:34269923:-1 gene:Os02g0803700 transcript:Os02t0803700-01 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:rice homolog of HIV-1 Tat binding protein-1, homolog of human TBP-1, 19S regulatory particle ATPase subunit 5a, RP triple A-ATPase 5a description:Similar to 26S protease regulatory subunit 6A homolog (TAT-binding protein homolog 1) (TBP-1). (Os02t0803700-01);Similar to 26S protease regulatory subunit 6A homolog. (Os02t0803700-03) |
| Sequence | MSSPPPAAAAAMAVDDADDDQLASMSTEDIVRATRLLDNETRVLKDELQRTNLEVESYKE |
| Transcript ID | Os02t0803700-01 |
| Transcript Infomation | cdna chromosome:IRGSP-1.0:2:34266081:34269923:-1 gene:Os02g0803700 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:rice homolog of HIV-1 Tat binding protein-1, homolog of human TBP-1, 19S regulatory particle ATPase subunit 5a, RP triple A-ATPase 5a description:Similar to 26S protease regulatory subunit 6A homolog (TAT-binding protein homolog 1) (TBP-1). (Os02t0803700-01);Similar to 26S protease regulatory subunit 6A homolog. (Os02t0803700-03) |
| Sequence | ACAGTAAACTGACCAACGCAAACCGCATCGATCAACTCCTTCCCCAAGTCGAAGCAAAAT |