Solanum melongena| Marker ID | t4111.P0000001 | |
|---|---|---|
| Marker Name | Solyc02g032200.2_HRMFW | |
| Type | other | |
| Position on the Genome | Reference Genome | Eggplant_V4.1 |
| Chromosome | NA | |
| Fw Primer | ACCTGAGGGACTGCAAGAGT | |
Start Position |
0 |
|
End Position |
0 |
|
| Rv Primer | NA | |
Start Position |
0 |
|
End Position |
0 |
|
| Target Sequences | NA | |
| Chromosome | NA | |
| Start Position | 0 | |
| End Position | 0 | |
| Allele [Sample Name] | NA | |
| Restriction Enzyme | NA | |
| Comment | HRM, These 3 HRM markers were added to previously developed genetic map and mapped on E02. Newly developed map, which includes 418 makers (339 SNPs, 5 HRMs, 3 CAPSs, 11 RFLPs, 33 SSRs and 27 COSII) and spans 1,390 cM., was the basis for QTL analyses. | |
| DOI | 10.1007/s10681-017-2102-2 | |
| PubMed | NA | |
