marker_id species_id marker_name sub_number marker_type mapped_genome_id reference_seq_name chr fwd_primer_seq fwd_primer_start_pos fwd_primer_end_pos rev_primer_seq rev_primer_start_pos rev_primer_end_pos target_seq target_chr target_start_pos target_end_pos allele enzyme comments doi pubmed f_active assembly_version t4513.P000001.1 t4513 ABG388 1 CAPS t4513.G001 0 chr6H gcactggcatagtctcacaa 480667799 480667818 cgatgctggttcggtcatac 480668102 480668083 6H NlaIII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000003.1 t4513 BCD276 1 CAPS t4513.G001 0 chr6H caatttgcgtagccgatgataaca 564085762 564085785 ttgggccagttgttagtgaaggac 564087321 564087298 6H MwoI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000004.1 t4513 MWG2068 1 CAPS t4513.G001 0 chr2H atgcgttggcccattgg 754655638 754655654 ccgtgagatgtaagttgctgg 754656322 754656302 2H HaeIII;Sau96I 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000005.1 t4513 MWG2200 1 CAPS t4513.G001 0 chr2H atcctggagtacctcgaagccg 763821731 763821752 agcacggcctccagcaccac 763822086 763822067 2H AvaI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000006.1 t4513 MWG502 1 CAPS t4513.G001 0 chr5H ctctgaagcatggaaccagatttg 3759218 3759240 tgtttagctaagctgttgctgagg 3759659 3759636 5H MspI;HpaII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000007.1 t4513 MWG584 1 CAPS t4513.G001 0 chr3H ttggaggagagcggaagagat 28893892 28893912 aaggcaagattggacgaggttt 28894264 28894243 3H StuI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000010.1 t4513 MWG835A 1 CAPS t4513.G001 0 chr1H ctcatctgaaacatcgtacaacg 4276976 4276997 ggggctggaaattattatcacact 4277314 4277291 1H XhoI;AvaI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000011.1 t4513 MWG897 1 CAPS t4513.G001 0 chrUn ggatcagtgatttcgccgtgtttct 92873447 92873471 ccatgatgcaaagctccaactactc 92874600 92874576 6H DdeI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000012.1 t4513 MWG911B 1 CAPS t4513.G001 0 chr5H tctccgagcgtgtctactgtc 566855250 566855270 atggtgcagctgggtgatg 566855545 566855527 7H FnuDII;HpyCH4IV Blast_hit_num.:3 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000013.1 t4513 Prx2 1 CAPS t4513.G001 0 chr2H tcatggacctcgcgaactgctc 759627493 759627514 tctccggcgcccacaccttc 759627825 759627806 2H AciI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000014.1 t4513 WBE101 1 CAPS t4513.G001 0 chr7H cgagcgcctgacggacgat 516658114 516658132 ctcacggcccagacatagc 516658674 516658656 7H HpyCH4IV 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000015.1 t4513 WBE103 1 CAPS t4513.G001 0 chr6H ggtggccctggtgaactacg 383274923 383274942 ctggctttaagaacactggaacat 383276083 383276060 6H TaqI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000016.1 t4513 WBE104 1 CAPS t4513.G001 0 chr4H atggcatcctcctgttccttcctt 644480974 644480997 cgggctgatgggggttgg 644481621 644481604 4H PsuI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000017.1 t4513 WBE105 1 CAPS t4513.G001 0 chr2H catggccgccgtgagcagtgac 47448503 47448524 gcagttggcccggagagttgtgg 47449215 47449193 2H BccI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000018.1 t4513 WBE106 1 CAPS t4513.G001 0 chr7H cggccagacttcccacgagaccac 636589021 636589044 gcaccgcgagcccgatgttga 636589881 636589861 7H AluI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000019.1 t4513 WBE107 1 CAPS t4513.G001 0 chr7H ctcggcggtgctcttcctcctc 655345419 655345440 gtggcgacgtcgttggggtgtt 655345883 655345862 7H BsrI Blast_hit_num.:2 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000020.1 t4513 WBE108 1 CAPS t4513.G001 0 chr5H aacaacaatggccgcctcgtcgtc 8764464 8764487 ttgggctccggtggcgtgtgatac 8764934 8764911 5H HpyCH4IV 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000021.1 t4513 WBE110 1 CAPS t4513.G001 0 chr2H gcaggaagcgaaggtggcaatagc 755093788 755093811 ccgaacagggaaacaccgacgaac 755095102 755095079 2H HaeIII;AciI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000023.1 t4513 WBE112 1 CAPS t4513.G001 0 chr3H atctccgggtcctgctggctcctc 6928965 6928988 ctcgcccccttcgcctacttcctc 6930042 6930019 3H MwoI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000024.1 t4513 WBE113 1 CAPS t4513.G001 0 chr2H gtagctgcccttcccctcgttcac 755196446 755196469 tcctcgccctcttcatcatcctca 755196939 755196916 2H MboI Blast_hit_num.:2 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P000030.1 t4513 M9646 1 CAPS t4513.G001 0 chr2H GTGTTAGGGCTGGTGGTGGAAT 42964255 42964276 AGATGCTCGACCTCAAGACACG 42964586 42964565 XhoI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000031.1 t4513 COM2/FZP 1 CAPS t4513.G001 0 chr2H CAGTGGGAGAGGAAGCTGAA 54394552 54394571 GAAGCTCACAGCAACCACCT 54395695 54395676 HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000032.1 t4513 M1557975 1 CAPS t4513.G001 0 chr2H GATGGCACTGGGAAGGTGAACC 70640884 70640905 GCGTGACAATGTACGGCTCCG 70641405 70641385 NsiI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000033.1 t4513 M1865727 1 CAPS t4513.G001 0 chr2H GAGCTCCCTTACCAGCAGTGC 110948332 110948352 CGAGGCACACAGGAGATGCAG 110948801 110948781 KpnI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000034.1 t4513 M5729 1 CAPS t4513.G001 0 chr2H GCCATGAGACTGGATCTAGTAC 590444109 590444130 CCACCGTTGACAAGATCACTG 590444400 590444380 RsaI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000035.1 t4513 M41820 1 CAPS t4513.G001 0 chr2H ACATTCGATGCAGTTGGAGAAGGC 607170362 607170385 GCTTTCCATGAGGCGGTGTCT 607170636 607170616 TaqI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000036.1 t4513 M162436 1 CAPS t4513.G001 0 chr2H CGATCGTCTTCACGTTCAC 616730167 616730185 GAGTATCATGGAGGCGAAG 616730393 616730375 HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000037.1 t4513 M47875 1 CAPS t4513.G001 0 chr2H ACTAAAGCTCAACCTGGTCCATCC 620957953 620957976 TGGCAATGAAAAGGCTTGCACA 620958415 620958394 MboII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000038.1 t4513 M37913 1 CAPS t4513.G001 0 chr2H GGTTTCAGCTTCCCAACTCTACCTG 634328923 634328947 GCGGGCATACTTGCTGAAGATG 634329313 634329292 RsaI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000039.1 t4513 M41923 1 CAPS t4513.G001 0 chr2H TTGAGTAGATGAGGTGCGGC 651464797 651464816 TGGTCATCATTCAGCGCCATA 651465081 651465061 MboII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000040.1 t4513 M121208 1 CAPS t4513.G001 0 chr2H CCCTACGACTATGGCTACGC 670602319 670602338 TGGAAATAGGAAGACGCGCA 670602625 670602606 HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000041.1 t4513 FL39449 1 CAPS t4513.G001 0 chr6H CATTAGCACGGAGAACCGGCAC 24465579 24465600 GCTGGTTCTTGCCTTGACGACC 24465922 24465901 PstI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000042.1 t4513 FL52245 1 CAPS t4513.G001 0 chr6H GGCTAGGGTGCTGACCATGATG 30653859 30653880 CTGCTCTGGCTGCAGTTTGC 30654197 30654178 StyI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000043.1 t4513 FL209450 1 CAPS t4513.G001 0 chr6H TAGACTCACATCATCGGCTG 144205379 144205398 TATCCGCTTCCTTTCACACA 144205604 144205585 HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000044.1 t4513 FL52776 1 CAPS t4513.G001 0 chr6H CTCCCGATTTGACCTGTTGACCC 412737365 412737387 CCTGGACAACCTGGCAATGC 412737573 412737554 HincII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000045.1 t4513 FL138846 1 CAPS t4513.G001 0 chr6H AGATACAGTAATGTCCGAGAC 468783757 468783777 AGTTTGAGCCTATTATCGGTC 468784069 468784049 NciI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000046.1 t4513 FL42060 1 CAPS t4513.G001 0 chr6H GATACACCCACGGTCAATTC 529226924 529226943 AGTGTACGTGTACATGCTATG 529227140 529227120 HincII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P000047.1 t4513 2212 1 CAPS t4513.G001 0 chr6H GCTCCATTGCTTTCGTCTTC 554481481 554481500 ATCCAAGAACTTGTGACCGC 554481776 554481757 HindIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000616 t4513 ABG388 1 CAPS t4513.G001 IBSC_v2 chr6H gcactggcatagtctcacaa 480667799 480667818 cgatgctggttcggtcatac 480668102 480668083 NA NA 0 0 6H NlaIII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000619 t4513 BCD276 1 CAPS t4513.G001 IBSC_v2 chr6H caatttgcgtagccgatgataaca 564085762 564085785 ttgggccagttgttagtgaaggac 564087321 564087298 NA NA 0 0 6H MwoI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000620 t4513 cMWG679 1 CAPS t4513.G001 IBSC_v2 NA gagcagcccgtgacatggaa 0 0 ctccaccagtgcaacctcgt 0 0 NA NA 0 0 6H BssKI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000621 t4513 MWG2068 1 CAPS t4513.G001 IBSC_v2 chr2H atgcgttggcccattgg 754655638 754655654 ccgtgagatgtaagttgctgg 754656322 754656302 NA NA 0 0 2H HaeIII;Sau96I 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000622 t4513 MWG2200 1 CAPS t4513.G001 IBSC_v2 chr2H atcctggagtacctcgaagccg 763821731 763821752 agcacggcctccagcaccac 763822086 763822067 NA NA 0 0 2H AvaI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000623 t4513 MWG502 1 CAPS t4513.G001 IBSC_v2 chr5H ctctgaagcatggaaccagatttg 3759218 3759240 tgtttagctaagctgttgctgagg 3759659 3759636 NA NA 0 0 5H MspI;HpaII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000624 t4513 MWG584 1 CAPS t4513.G001 IBSC_v2 chr3H ttggaggagagcggaagagat 28893892 28893912 aaggcaagattggacgaggttt 28894264 28894243 NA NA 0 0 3H StuI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000627 t4513 MWG835A 1 CAPS t4513.G001 IBSC_v2 chr1H ctcatctgaaacatcgtacaacg 4276976 4276997 ggggctggaaattattatcacact 4277314 4277291 NA NA 0 0 1H XhoI;AvaI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000628 t4513 MWG889B 1 CAPS t4513.G001 IBSC_v2 NA ccctgaattcacgcgttatt 0 0 gaatgagcaactaccgcata 0 0 NA NA 0 0 7H BglII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000629 t4513 MWG897 1 CAPS t4513.G001 IBSC_v2 chrUn ggatcagtgatttcgccgtgtttct 92873447 92873471 ccatgatgcaaagctccaactactc 92874600 92874576 NA NA 0 0 6H DdeI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000630 t4513 MWG911B 1 CAPS t4513.G001 IBSC_v2 chr5H tctccgagcgtgtctactgtc 566855250 566855270 atggtgcagctgggtgatg 566855545 566855527 NA NA 0 0 7H FnuDII;HpyCH4IV Blast_hit_num.:3 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000631 t4513 Prx2 1 CAPS t4513.G001 IBSC_v2 chr2H tcatggacctcgcgaactgctc 759627493 759627514 tctccggcgcccacaccttc 759627825 759627806 NA NA 0 0 2H AciI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000632 t4513 WBE100 1 dCAPS t4513.G001 IBSC_v2 NA ctgtagtaataggtcagtccgc 0 0 acggagggagtaagcatctat 0 0 NA NA 0 0 5H BsH1236I 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000633 t4513 WBE101 1 CAPS t4513.G001 IBSC_v2 chr7H cgagcgcctgacggacgat 516658114 516658132 ctcacggcccagacatagc 516658674 516658656 NA NA 0 0 7H HpyCH4IV 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000634 t4513 WBE102 1 CAPS t4513.G001 IBSC_v2 NA ctttccccttcctcctcccaccag 0 0 ggcaaccctcacaccatacataca 0 0 NA NA 0 0 4H MnlI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000635 t4513 WBE103 1 CAPS t4513.G001 IBSC_v2 chr6H ggtggccctggtgaactacg 383274923 383274942 ctggctttaagaacactggaacat 383276083 383276060 NA NA 0 0 6H TaqI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000636 t4513 WBE104 1 CAPS t4513.G001 IBSC_v2 chr4H atggcatcctcctgttccttcctt 644480974 644480997 cgggctgatgggggttgg 644481621 644481604 NA NA 0 0 4H PsuI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000637 t4513 WBE105 1 CAPS t4513.G001 IBSC_v2 chr2H catggccgccgtgagcagtgac 47448503 47448524 gcagttggcccggagagttgtgg 47449215 47449193 NA NA 0 0 2H BccI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000638 t4513 WBE106 1 CAPS t4513.G001 IBSC_v2 chr7H cggccagacttcccacgagaccac 636589021 636589044 gcaccgcgagcccgatgttga 636589881 636589861 NA NA 0 0 7H AluI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000639 t4513 WBE107 1 CAPS t4513.G001 IBSC_v2 chr7H ctcggcggtgctcttcctcctc 655345419 655345440 gtggcgacgtcgttggggtgtt 655345883 655345862 NA NA 0 0 7H BsrI Blast_hit_num.:2 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000640 t4513 WBE108 1 CAPS t4513.G001 IBSC_v2 chr5H aacaacaatggccgcctcgtcgtc 8764464 8764487 ttgggctccggtggcgtgtgatac 8764934 8764911 NA NA 0 0 5H HpyCH4IV 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000641 t4513 WBE110 1 CAPS t4513.G001 IBSC_v2 chr2H gcaggaagcgaaggtggcaatagc 755093788 755093811 ccgaacagggaaacaccgacgaac 755095102 755095079 NA NA 0 0 2H HaeIII;AciI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000643 t4513 WBE112 1 CAPS t4513.G001 IBSC_v2 chr3H atctccgggtcctgctggctcctc 6928965 6928988 ctcgcccccttcgcctacttcctc 6930042 6930019 NA NA 0 0 3H MwoI 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000644 t4513 WBE113 1 CAPS t4513.G001 IBSC_v2 chr2H gtagctgcccttcccctcgttcac 755196446 755196469 tcctcgccctcttcatcatcctca 755196939 755196916 NA NA 0 0 2H MboI Blast_hit_num.:2 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000645 t4513 WBE201 1 CAPS t4513.G001 IBSC_v2 NA ggtcagcaattccccaaagtt 0 0 aatgccgaaatctcccaaatga 0 0 NA NA 0 0 6H MnlII 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000646 t4513 WBE205 1 CAPS t4513.G001 IBSC_v2 NA gagggtcgcaatcttcttttc 0 0 agcacttggccttttatgaca 0 0 NA NA 0 0 6H Hin1I 10.1007/s00122-006-0448-2 17115126 1 IBSC_v2 t4513.P0000661 t4513 M9646 1 CAPS t4513.G001 IBSC_v2 chr2H GTGTTAGGGCTGGTGGTGGAAT 42964255 42964276 AGATGCTCGACCTCAAGACACG 42964586 42964565 NA NA 0 0 NA XhoI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000662 t4513 COM2/FZP 1 CAPS t4513.G001 IBSC_v2 chr2H CAGTGGGAGAGGAAGCTGAA 54394552 54394571 GAAGCTCACAGCAACCACCT 54395695 54395676 NA NA 0 0 NA HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000663 t4513 M1557975 1 CAPS t4513.G001 IBSC_v2 chr2H GATGGCACTGGGAAGGTGAACC 70640884 70640905 GCGTGACAATGTACGGCTCCG 70641405 70641385 NA NA 0 0 NA NsiI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000664 t4513 M1865727 1 CAPS t4513.G001 IBSC_v2 chr2H GAGCTCCCTTACCAGCAGTGC 110948332 110948352 CGAGGCACACAGGAGATGCAG 110948801 110948781 NA NA 0 0 NA KpnI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000665 t4513 M5729 1 CAPS t4513.G001 IBSC_v2 chr2H GCCATGAGACTGGATCTAGTAC 590444109 590444130 CCACCGTTGACAAGATCACTG 590444400 590444380 NA NA 0 0 NA RsaI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000666 t4513 M41820 1 CAPS t4513.G001 IBSC_v2 chr2H ACATTCGATGCAGTTGGAGAAGGC 607170362 607170385 GCTTTCCATGAGGCGGTGTCT 607170636 607170616 NA NA 0 0 NA TaqI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000667 t4513 M162436 1 CAPS t4513.G001 IBSC_v2 chr2H CGATCGTCTTCACGTTCAC 616730167 616730185 GAGTATCATGGAGGCGAAG 616730393 616730375 NA NA 0 0 NA HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000668 t4513 M47875 1 CAPS t4513.G001 IBSC_v2 chr2H ACTAAAGCTCAACCTGGTCCATCC 620957953 620957976 TGGCAATGAAAAGGCTTGCACA 620958415 620958394 NA NA 0 0 NA MboII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000669 t4513 M37913 1 CAPS t4513.G001 IBSC_v2 chr2H GGTTTCAGCTTCCCAACTCTACCTG 634328923 634328947 GCGGGCATACTTGCTGAAGATG 634329313 634329292 NA NA 0 0 NA RsaI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000670 t4513 M41923 1 CAPS t4513.G001 IBSC_v2 chr2H TTGAGTAGATGAGGTGCGGC 651464797 651464816 TGGTCATCATTCAGCGCCATA 651465081 651465061 NA NA 0 0 NA MboII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000671 t4513 M121208 1 CAPS t4513.G001 IBSC_v2 chr2H CCCTACGACTATGGCTACGC 670602319 670602338 TGGAAATAGGAAGACGCGCA 670602625 670602606 NA NA 0 0 NA HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000672 t4513 FL39449 1 CAPS t4513.G001 IBSC_v2 chr6H CATTAGCACGGAGAACCGGCAC 24465579 24465600 GCTGGTTCTTGCCTTGACGACC 24465922 24465901 NA NA 0 0 NA PstI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000673 t4513 FL52245 1 CAPS t4513.G001 IBSC_v2 chr6H GGCTAGGGTGCTGACCATGATG 30653859 30653880 CTGCTCTGGCTGCAGTTTGC 30654197 30654178 NA NA 0 0 NA StyI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000674 t4513 FL209450 1 CAPS t4513.G001 IBSC_v2 chr6H TAGACTCACATCATCGGCTG 144205379 144205398 TATCCGCTTCCTTTCACACA 144205604 144205585 NA NA 0 0 NA HaeIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000675 t4513 FL52776 1 CAPS t4513.G001 IBSC_v2 chr6H CTCCCGATTTGACCTGTTGACCC 412737365 412737387 CCTGGACAACCTGGCAATGC 412737573 412737554 NA NA 0 0 NA HincII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000676 t4513 FL138846 1 CAPS t4513.G001 IBSC_v2 chr6H AGATACAGTAATGTCCGAGAC 468783757 468783777 AGTTTGAGCCTATTATCGGTC 468784069 468784049 NA NA 0 0 NA NciI The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000677 t4513 FL42060 1 CAPS t4513.G001 IBSC_v2 chr6H GATACACCCACGGTCAATTC 529226924 529226943 AGTGTACGTGTACATGCTATG 529227140 529227120 NA NA 0 0 NA HincII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2 t4513.P0000678 t4513 2212 1 CAPS t4513.G001 IBSC_v2 chr6H GCTCCATTGCTTTCGTCTTC 554481481 554481500 ATCCAAGAACTTGTGACCGC 554481776 554481757 NA NA 0 0 NA HindIII The mentioned markers are SNPs and they were converted to restriction enzyme based cleaved amplified polymorphic sequence (CAPS) markers for marker mapping in Morex amul2.b 10.1007/s00122-021-03986-w 34773464 1 IBSC_v2