marker_id	species_id	marker_name	sub_number	marker_type	mapped_genome_id	reference_seq_name	chr	fwd_primer_seq	fwd_primer_start_pos	fwd_primer_end_pos	rev_primer_seq	rev_primer_start_pos	rev_primer_end_pos	target_seq	target_chr	target_start_pos	target_end_pos	allele	enzyme	comments	doi	pubmed	f_active	assembly_version
t4111.M010394.1	t4111	SIVR844	1	Others	t4111.G001	Eggplant_V4.1	9	GAATCTTCACAAGCTCCAGCTCCAT	8071072	8071096	CTTTCCTTCAATCATCTCGT	8071915	8071897	NA				amplified (844 bp) [S. linnaeanum PI388846]; not amplified [S. melongena EP12]	NA		10.1007/s10681-014-1234-x	NA	1	Eggplant_V4.1
t4111.M010394.2	t4111	SIVR844	2	Others	t4111.G001	Eggplant_V4.1	9	GAATCTTCACAAGCTCCAGCTCCAT	17930814	17930838	CTTTCCTTCAATCATCTCGT	17932816	17932798	NA				amplified (844 bp) [S. linnaeanum PI388846]; not amplified [S. melongena EP12]	NA		10.1007/s10681-014-1234-x	NA	1	Eggplant_V4.1
t4111.M010398.1	t4111	Sme2.5_14440_15	1	Others	t4111.G001	Eggplant_V4.1	4	AAGGCATCTATGACAAAGGGAA	28132912	28132933	CCTCCACCCATAGCTAACAAAC	28134082	28134061	AGTTCCGCCTGACTTGAATACCCATCAACATAGAAAATTTATACATGATGTAAAGAAGTTCTTTTGGGATGAGCCATATTTATTTTGCATTTACGTGGATGGGATCATCCAATAATATGTTCCAGAAG				T [EPL-1]; G [LS1934]; T [WCGR112-8]	NA		10.1007/s00122-015-2632-8	26582508	1	Eggplant_V4.1
t4111.P0000001	t4111	Solyc02g032200.2_HRMFW	1	other	t4111.G001	Eggplant_V4.1	NA	ACCTGAGGGACTGCAAGAGT	0	0	NA	0	0	NA	NA	0	0	NA	NA	HRM, These 3 HRM markers were added to previously developed genetic map and mapped on E02. Newly developed map, which includes 418 makers (339 SNPs, 5 HRMs, 3 CAPSs, 11 RFLPs, 33 SSRs and 27 COSII) and spans 1,390 cM., was the basis for QTL analyses.	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000002	t4111	Solyc02g032200.2_HRMRV	1	other	t4111.G001	Eggplant_V4.1	NA	NA	0	0	CATCTGCATGGAGGGTTTTCA	0	0	NA	NA	0	0	NA	NA	HRM	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000003	t4111	Solyc02g037540.1_HRMFW	1	other	t4111.G001	Eggplant_V4.1	NA	GTGGTGCGACTTCATAAGTT	0	0	NA	0	0	NA	NA	0	0	NA	NA	HRM	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000004	t4111	Solyc02g037540.1_HRMRV	1	other	t4111.G001	Eggplant_V4.1	NA	NA	0	0	AACTCCTTCTGGCCCAATCA	0	0	NA	NA	0	0	NA	NA	HRM	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000005	t4111	Solyc02g032030.1_HRMFW	1	other	t4111.G001	Eggplant_V4.1	NA	CCAAGGGATCTATGGTTCAGC	0	0	NA	0	0	NA	NA	0	0	NA	NA	HRM	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000006	t4111	Solyc02g032030.1_HRMRV	1	other	t4111.G001	Eggplant_V4.1	NA	NA	0	0	TCAGCTTGGTAGGTTTTCGC	0	0	NA	NA	0	0	NA	NA	HRM	10.1007/s10681-017-2102-2	NA	1	Eggplant_V4.1
t4111.P0000019	t4111	SNP_38959	1	other	t4111.G001	Eggplant_V4.1	1	TGTGTGACTAGGACTTCATCCTC	17367373	17367395	GCCCTAGAAGGAGCTTTCATC	17367464	17367444	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000020	t4111	SNP_38905	1	other	t4111.G001	Eggplant_V4.1	1	TGAAGGAGAAGGACCAGCAG	13651987	13652007	TCAGCCCATATCAGATCTTGC	13652077	13652058	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000021	t4111	SNP_11564	1	other	t4111.G001	Eggplant_V4.1	2	AGGAGAATTGCAGAGTGATGC	56666529	56666549	TCGCAGCTCATAGCCATATTC	56666626	56666606	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000022	t4111	SNP_19191	1	other	t4111.G001	Eggplant_V4.1	2	AACCTCCCTAAAACCCCAAC	65424530	65424549	TGGCTCTGACAACTGGAAATC	65424632	65424612	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000023	t4111	SNP_38971	1	other	t4111.G001	Eggplant_V4.1	2	GATGGTGGTTCTGCGGTATC	77905371	77905390	TAGGTTCACCAGGCTCCATC	77905470	77905451	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000024	t4111	SNP_34715	1	other	t4111.G001	Eggplant_V4.1	3	CTAAGGGGCAGAGCTTCTTG	854295	854314	GACGCCAATAGTTAATAGAACTGC	854388	854365	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000025	t4111	SNP_00907	1	other	t4111.G001	Eggplant_V4.1	3	GGGAAAGAAAGGAGGAATGG	40760914	40760937	AAATTTTGGATTTCCATCATCTTC	40761001	40760982	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000026	t4111	SNP_27060	1	other	t4111.G001	Eggplant_V4.1	3	TGTTCCTCACTCAATGTGTCG	97572040	97572058	AGGTGCACCGATTCTTTCC	97572142	97572122	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000027	t4111	SNP_13379	1	other	t4111.G001	Eggplant_V4.1	3	CTTCTCTCCCACCAGGCTAC	93312427	93312446	TGGCAGCATACCAAATAGGC	93312525	93312506	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000028	t4111	SNP_23081	1	other	t4111.G001	Eggplant_V4.1	0	AAGTACCTCTGCAGCAACAGC	71600	71619	TCATCACCAAATCTCCATCG	71701	71681	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000029	t4111	SNP_39035	1	other	t4111.G001	Eggplant_V4.1	4	CCCGTTACTTCAAGGGGATG	37973408	37973427	CACTGCCTTTCCAAATGAGG	37973503	37973484	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000030	t4111	SNP_23613	1	other	t4111.G001	Eggplant_V4.1	4	AAATCCAATTCACAGACATTGC	82593589	82593610	TGTTGATATCACCGACAACG	82593687	82593668	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000031	t4111	SNP_15567	1	other	t4111.G001	Eggplant_V4.1	9	TCAAATGAATGTGAGGAACAGG	57211889	57211910	TGGAAGAGGAAGAGGCTGAG	57211981	57211962	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000032	t4111	SNP_00676	1	other	t4111.G001	Eggplant_V4.1	5	CTCGGGGTCCAGAACTAGAA	81359000	81359019	CCTACTCCAGGGCTTCCTTC	81359104	81359085	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000033	t4111	SNP_19562	1	other	t4111.G001	Eggplant_V4.1	5	GCATCTCAATGTAAAAGCTTCC	6429015	6429034	GCCTTTGAGTCCGAGTTCAG	6429531	6429510	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000034	t4111	SNP_10686	1	other	t4111.G001	Eggplant_V4.1	6	GCACAATTAGCTGGTGTTGG	5674402	5674421	AAGAGATTGTTGAAGAAAGACGTG	5674511	5674488	NA	NA	0	0	4	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000035	t4111	SNP_32044	1	other	t4111.G001	Eggplant_V4.1	6	GACCTAGGCAAGAACGAAGG	80135141	80135160	TGTAGGACGCTATCCCATTG	80135228	80135209	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000036	t4111	SNP_37940	1	other	t4111.G001	Eggplant_V4.1	6	CGGCTATGTACTTCATAACAGC	95373395	95373414	CCCAGAAATGATTTGCGAAG	95373493	95373472	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000037	t4111	SNP_30643	1	other	t4111.G001	Eggplant_V4.1	7	CACGGTCACTGCTTTCTCTG	2656777	2656796	AGATGGTGAGCCTTCCTACG	2656878	2656859	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000038	t4111	SNP_31222	1	other	t4111.G001	Eggplant_V4.1	7	CCTCCACCTACCCTCAACTC	2869763	2869782	AAGAAGCGCGAGTTGTTCAG	2869864	2869845	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000039	t4111	SNP_01600	1	other	t4111.G001	Eggplant_V4.1	7	GGGAGGGTGGTAAAGGAGTG	108460543	108460562	GGTTTTCACTCAGCCGCTAC	108460657	108460638	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000040	t4111	SNP_23399	1	other	t4111.G001	Eggplant_V4.1	7	TAGAGATGGCCTCGGGAAG	101252840	101252858	GGAAGATAGATCAAAACGAGCTG	101252946	101252924	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000041	t4111	SNP_17586	1	other	t4111.G001	Eggplant_V4.1	8	CTCCGGAATAAATGCAAACC	159366	159385	CCTGTCAATGGAGATGTTCG	159463	159444	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000042	t4111	SNP_02438	1	other	t4111.G001	Eggplant_V4.1	8	GAGACAGGGGATGATGAAGG	2338573	2338592	GATGGCACATTGCACCTAAC	2338688	2338669	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000043	t4111	SNP_38436	1	other	t4111.G001	Eggplant_V4.1	8	TTGATGCAATAAAGGAAGTGG	88418323	88418343	AGGCAGATGGGACACTCTTC	88418428	88418409	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000044	t4111	SNP_32294	1	other	t4111.G001	Eggplant_V4.1	9	TAGCAAGCTTACGGCTGGTC	2442361	2442380	CAACTGAAGTGGCATGATGG	2442476	2442457	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000045	t4111	SNP_14499	1	other	t4111.G001	Eggplant_V4.1	9	CGGAACAAAAAGCTTTCAACC	91654354	91654373	ATGCTTCTTTGGGGCTAGAG	91654445	91654425	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000046	t4111	SNP_13910	1	other	t4111.G001	Eggplant_V4.1	NA	CCCATAAGGTCGCGTAATTC	0	0	TCACCCGCAAACCTACTCTC	0	0	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000047	t4111	SNP_14015	1	other	t4111.G001	Eggplant_V4.1	10	TGCCCCATTTCTTCAACTTC	3656431	3656450	CAGCCATCTTCTCCTGGTAG	3656548	3656529	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000048	t4111	SNP_39817	1	other	t4111.G001	Eggplant_V4.1	10	TGTTGTGGACACGGCTACTC	4895753	4895772	CAAATGTTCTAGGCCCATTCC	4895852	4895832	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000049	t4111	SNP_14306	1	other	t4111.G001	Eggplant_V4.1	11	TGGCATCAGCAGTCGTTG	1697155	1697172	CATGGGGAATTGAATTTTGG	1697271	1697252	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000050	t4111	SNP_39475	1	other	t4111.G001	Eggplant_V4.1	11	CACATTGGTGAAAGCCATTG	10700309	10700327	CTGGCTGCCTCTTGTTGAG	10700419	10700400	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000051	t4111	SNP_29844	1	other	t4111.G001	Eggplant_V4.1	1	GCTCGCTTAGGATGAATTTCC	7514398	7514417	GCATATGGTGGAGGTGGTTC	7514492	7514473	NA	NA	0	0	3	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000052	t4111	SNP_14718	1	other	t4111.G001	Eggplant_V4.1	12	TCATGGGTTGCATTGTGAAC	74529793	74529812	TGCCGACGTAAAGGTCAATC	74529888	74529869	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000053	t4111	SNP_30456	1	other	t4111.G001	Eggplant_V4.1	12	ACTGGCCAAGCTTTTGCTAC	75169017	75169036	GTGTGGGCTCTAAGGGAATG	75169122	75169103	NA	NA	0	0	2	NA	SNP	10.1007/s10681-017-2057-3	NA	1	Eggplant_V4.1
t4111.P0000064	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	ATGGCAAGGCCAACAAG	69665425	69665441	TCATAGACTTAAACTTGTGGAAGATG	69666842	69666817	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394440-F and SMEL12g394440-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000065	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	NA	ATGCCTAGACCAAGATGGAGTC	0	0	CTACTCCTTAATGCCAGTGGC	0	0	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394430-F and SMEL12g394430-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000066	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	CCACACTTCTCATATTGCTGTCA	74207514	74207536	ACCAGCATCACCATTCTTCAAAA	74207625	74207603	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (EF1A-egg-F and EF1A-egg-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000067	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	ACAGACATGGGCTCAAATTCT	69642461	69642481	AGTGGCTGTGATAGGGAAAAG	69642541	69642521	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394430-RT-F and SMEL12g394430-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000068	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	ACAACTACCACTAGCAACAACTCCAAT	69665692	69665718	GAAGAAGTCCAGTAGATGTTAAAGGGCATA	69665806	69665777	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394440-RT-F and SMEL12g394440-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000069	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	AGCTGTCCTGTGGTTTTCAG	69620378	69620399	AGTGGGTTTTGGTGAATTTGTG	69620524	69620505	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394410-RT-F and SMEL12g394410-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000070	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	CACAAAATCACCCAAACCCAC	69618036	69618058	CGAGACTCATTCCTACCTTAACG	69618160	69618140	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394400-RT-F and SMEL12g394400-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000071	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	GAAGGATAGAGGTGTTGGTGAC	69614628	69614649	CTTCTCTGCTCTACTGAACCAG	69614771	69614750	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394390-RT-F and SMEL12g394390-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000072	t4111	NA	1	other	t4111.G001	Eggplant_V4.1	12	CAAGTACAAGTCCTAGAAGGGC	69624484	69624505	CATTTCTCTTGCGTTTTAGCCC	69624622	69624601	NA	NA	0	0	NA	NA	NA, Quantitative Real-Time PCR primers details (SMEL12g394420-RT-F and SMEL12g394420-RT-R)	10.3389/fpls.2021.731079	34567042	1	Eggplant_V4.1
t4111.P0000078	t4111	SmTgn1_03	1	other	t4111.G001	Eggplant_V4.1	NA	GGTTAACAATGGCTGAGGATTC	0	0	GCACAAAACTTTACTGCTTCCC	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000079	t4111	SmTgn1_14	1	other	t4111.G001	Eggplant_V4.1	6	TGAAGAAAATCCTTGGATCTGG	92533987	92534008	ACCTCCACCAGAAGGTACTGAA	92535226	92535205	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000080	t4111	SmTgn1_19	1	other	t4111.G001	Eggplant_V4.1	NA	TGAGCCTTGGAATTGGAGATAC	0	0	GGTGTTTAGAGACACAGGAGGC	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000081	t4111	SmTgn1_22	1	other	t4111.G001	Eggplant_V4.1	NA	TGCGAAGAAGGATTTCTCTACC	0	0	TTCATCCTAATCTTCGGCTCAT	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000082	t4111	SmTgn1_25	1	other	t4111.G001	Eggplant_V4.1	6	ACAGAAACTGAGCTTGAGGACC	93268854	93268875	TCCAGCATTCTGAGCTATCAAA	93269730	93269709	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000083	t4111	SmTgn1_26	1	other	t4111.G001	Eggplant_V4.1	6	CAATTGACAAAGTTGGTCCTGA	93269640	93269661	CACCAGGTACAATTCCCTCTTC	93271407	93271386	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000084	t4111	SmTgn1_28	1	other	t4111.G001	Eggplant_V4.1	NA	GGATTGGACTTCGCTCTTAGAA	0	0	GCAGGCGATGTTATAATCTGGT	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000085	t4111	SmTgn1_29	1	other	t4111.G001	Eggplant_V4.1	NA	CTGGTGTAGTGATCCACGGTTA	0	0	TTCTAAGAGCGAAGTCCAATCC	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening also co-segregated with the prickly phenotype.	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000086	t4111	SmTgn1_30	1	other	t4111.G001	Eggplant_V4.1	NA	ATTCATGCTATTGGAAACAGCC	0	0	CCGTAATATCTTACAGGCAGCA	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000087	t4111	SmTgn1_33	1	other	t4111.G001	Eggplant_V4.1	6	ATGCAGCAGCAGCACTTCTC	93730302	93730321	ATCCCTGTATGGCTGACCTAAA	93731289	93731268	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000088	t4111	SmTgn2_31k	1	other	t4111.G001	Eggplant_V4.1	6	CAAATATTCAACATAAACTCCAATGAA	93294863	93294889	GCTCTGCTTATCTCAATCCAGGT	93296062	93296040	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000089	t4111	SmTgn2_113k	1	other	t4111.G001	Eggplant_V4.1	NA	ATCAGCTGGTTCATGGGAAG	0	0	CAGCTGATGAGACGAAACGA	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000090	t4111	SmTgn2_133k	1	other	t4111.G001	Eggplant_V4.1	NA	TCCATGTCCCCTTATCCGTA	0	0	GAGCATCACTCCCCCATAAA	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000091	t4111	SmTgn2_155k	1	other	t4111.G001	Eggplant_V4.1	6	GGGGTATTTATGCGAATGACC	93434948	93434968	TTCAATTCATCAAGGCCATAAG	93436353	93436332	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000092	t4111	SmTgn2_163k	1	other	t4111.G001	Eggplant_V4.1	6	GACGGATGGAGTACTTTGCTTC	93442550	93442571	GGCGCTCCCAACAGTATTT	93443959	93443941	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000093	t4111	SmTgn2_190k	1	other	t4111.G001	Eggplant_V4.1	6	TTTCACACCAATCGACTTAGC	93471611	93471636	AAATGTCACATAGATATGGATGGAAG	93472791	93472771	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000094	t4111	SmTgn2_253kA	1	other	t4111.G001	Eggplant_V4.1	6	CCAAGAAGGAAACGAAACCA	93540694	93540713	TTGCAACAACCAGACTGCAT	93541859	93541840	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000095	t4111	SmTgn2_253kB	1	other	t4111.G001	Eggplant_V4.1	NA	TCTTGTGGCACAGATCTTGAA	0	0	GCACACATCTTGCTATTCAAAG	0	0	NA	NA	0	0	NA	NA	SNP, PCR primers used in genetic mapping of the Pl locus and BAC screening	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000096	t4111	pl_indel_0.5k	1	other	t4111.G001	Eggplant_V4.1	NA	CGTTACATGCATAATAAACCTACGC	0	0	CAAAGCCGCAGCCTACTG	0	0	NA	NA	0	0	NA	NA	Indel, PCR primers used in genetic mapping of the Pl locus and BAC screening (developed to amplify the 0.5-kb insertion). Also, In conclusion, most of the prickly eggplant accessions in the WEC collection, excluding 9 accessions, could be used as breeding materials in marker assisted selection (MAS) with a set of togenashi-senryo-nigo and the pl_indel_0.5k.	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000097	t4111	BAC end seuencing	1	other	t4111.G001	Eggplant_V4.1	NA	GGATGTGCTGCAAGGCGATTAAGTTGG	0	0	CTCGTATGTTGTGTGGAATTGTGAGC	0	0	NA	NA	0	0	NA	NA	NA, BAC end sequencing was conducted with the primers, pIndigo BAC5 Forward Sequencing Primer and pIndigo BAC5 Reverse Sequencing Primer.	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000098	t4111	Plasmid sequencing	1	other	t4111.G001	Eggplant_V4.1	NA	GTAAAACGACGGCCAGTGCC	0	0	GCGGATAACAATTTCACACAGG	0	0	NA	NA	0	0	NA	NA	NA, Plasmid sequencing was then conducted with the primers, fw-dtSeq and rv-dtSeq.	10.1270/jsbbs.20004	32968346	1	Eggplant_V4.1
t4111.P0000109	t4111	Indel8-7	1	other	t4111.G001	Eggplant_V4.1	NA	GCAAGCCTATGAAGTTGAAG	0	0	CACCCTTCATATCACTTCCA	0	0	NA	NA	0	0	NA	NA	Indel	10.3390/ijms19030789	29522465	1	Eggplant_V4.1
t4111.P0000110	t4111	Indel8-11	1	other	t4111.G001	Eggplant_V4.1	NA	GTAGAGGGCAATGGCGGTTAG	0	0	GGGAAAGGTTCGGAGTAGGC	0	0	NA	NA	0	0	NA	NA	Indel	10.3390/ijms19030789	29522465	1	Eggplant_V4.1
t4111.P0000111	t4111	Indel8-17	1	other	t4111.G001	Eggplant_V4.1	NA	GCATTCCTCGGTGAACATCC	0	0	GTCTGCGTACATTCTACCCTC	0	0	NA	NA	0	0	NA	NA	Indel	10.3390/ijms19030789	29522465	1	Eggplant_V4.1
t4111.P0000115	t4111	GAPDH	1	other	t4111.G001	Eggplant_V4.1	NA	CCGCTCCTAGCAAAGATGCC	0	0	ACCCTCCACAATGCCAAACC	0	0	NA	NA	0	0	NA	NA	NA, qRT-PCR details	10.3390/ijms19030789	29522465	1	Eggplant_V4.1
t4111.P0000116	t4111	Sme2.5_01638.1_g00005.1	1	other	t4111.G001	Eggplant_V4.1	NA	GGTCAACTTGAGTGGGAGGA	0	0	TCCAATCCCAACCCAATCGA	0	0	NA	NA	0	0	NA	NA	NA, qRT-PCR for Anthocyanidin Synthase (ANS) gene also the preliminary results indicate that Sme2.5_01638.1_g00005.1 is the best candidate gene for SmFAS.	10.3390/ijms19030789	29522465	1	Eggplant_V4.1
t4111.P0000117	t4111	Sme2.5_01638.1_g00003.1	1	other	t4111.G001	Eggplant_V4.1	NA	CTATGAAGGAAACTGGGTAACTGC	0	0	CGTTGCTTAGGAACTCAATGGT	0	0	NA	NA	0	0	NA	NA	NA, qRT-PCR for Anthocyanidin Synthase (ANS) gene	10.3390/ijms19030789	29522465	1	Eggplant_V4.1