marker_id	species_id	marker_name	sub_number	marker_type	mapped_genome_id	reference_seq_name	chr	fwd_primer_seq	fwd_primer_start_pos	fwd_primer_end_pos	rev_primer_seq	rev_primer_start_pos	rev_primer_end_pos	target_seq	target_chr	target_start_pos	target_end_pos	allele	enzyme	comments	doi	pubmed	f_active	assembly_version
t4097.M000009.1	t4097	E4B1	1	CAPS	t4097.G001	Nitab4.5	Nt09	AGCAGACACAGTTGCTCTTCACATAAACT	101687882	101687908	TATCAGGATCAGACCAGAGTTTAGG	101688204	101688180	NA				323bp [CYP82E4 mutant of Burley (truncation mutation)]; A [CYP82E4 mutant of Burley (truncation mutation)]; 291bp [wildtype (Burley)]; G [wildtype (Burley)]	NA		10.1007/s11032-010-9528-8	NA	1	Nitab4.5
t4097.M000011.1	t4097	E4M1	1	CAPS	t4097.G001	Nitab4.5	Nt09	GGTCTAAAACGTGTGTTTGCTTT	101687655	101687677	TTTTGATTGTTTATCAATAATGCCATTCCT	101687941	101687913	NA				198bp [CYP82E4 mutant of Burley (truncation mutation)]; A [CYP82E4 mutant of Burley (truncation mutation)]; 236bp [wildtype (Burley)]; G [wildtype (Burley)]	NA		10.1007/s11032-010-9528-8	NA	1	Nitab4.5
t4097.M000013.1	t4097	E5H1	1	CAPS	t4097.G001	Nitab4.5	Nt09	AGAAAGCACAAGAAGAGATCGATAA	14479156	14479180	TCTCTCTGGATCAAACTTATCAGGATTTGG	14479427	14479399	NA				271bp [CYP82E5v2 mutant of Burley (truncation mutation)]; A [CYP82E5v2 mutant of Burley (truncation mutation)]; 241bp [wildtype (Burley)]; G [wildtype (Burley)]	NA		10.1007/s11032-010-9528-8	NA	1	Nitab4.5